Bio.Var: Biological Variation.
Identifying and counting sequence sites
You can identify and count the number of various types of site in a nucleotide sequence, or pair/set of aligned nucleotide sequences.
Different types of site
The abstract Site types
Site Mutation
The concrete types of site case
The types of mutations that can currently be counted are summarized below:
Gap Ambiguous Certain Match Mismatch Conserved Mutated Transition Transversion
The count_sites method
count_sites
count_sites(Match, [dna"ATCGATCG", dna"ACCGATCG"]) count_sites(Mismatch, [dna"ATCGATCG", dna"ACCGATCG"]) count_sites(Conserved, [dna"ATCGATCG", dna"ACCGATCG"]) count_sites(Mutated, [dna"ATCGATCG", dna"ACCGATCG"]) count_sites(Transition, [rna"AUCGAUCG", rna"ACCGAUCG"]) count_sites(Transversion, [rna"AUCGAUCG", rna"ACCGAUCG"])
File formats for representing genetic variation
This module supports some common file formats to read and write genetic variations.
VCF and BCF file formats
VCF and BCF file formats can be read using VCFReader and BCFReader, respectively:
reader = open(VCFReader, "example.vcf") for record in reader # do something end close(reader)
A reader first reads the header section of a file and creates a VCFHeader object. The header function is provided to access the header object of a reader:
julia> header(reader) Bio.Var.VCFHeader: metainfo tags: fileformat fileDate source reference contig phasing INFO FILTER FORMAT sample IDs: NA00001 NA00002 NA00003 julia> find(header(reader), "FORMAT") 4-element Array{Bio.Var.VCFMetaInfo,1}: Bio.Var.VCFMetaInfo: tag: FORMAT value: ID="GT" Number="1" Type="String" Description="Genotype" Bio.Var.VCFMetaInfo: tag: FORMAT value: ID="GQ" Number="1" Type="Integer" Description="Genotype Quality" Bio.Var.VCFMetaInfo: tag: FORMAT value: ID="DP" Number="1" Type="Integer" Description="Read Depth" Bio.Var.VCFMetaInfo: tag: FORMAT value: ID="HQ" Number="2" Type="Integer" Description="Haplotype Quality"
VCFMetaInfo objects in the header support the following accessor functions:
| Accessor | Description |
|---|---|
metainfotag |
tag string |
metainfoval |
value string |
keys |
keys of fields between '<' and '>' |
values |
values of fields between '<' and '>' |
[<key>] |
value of a field with key |
julia> metainfo = VCFMetaInfo("##FORMAT=<ID=GT,Number=1,Type=String,Description=\"Genotype\">") Bio.Var.VCFMetaInfo: tag: FORMAT value: ID="GT" Number="1" Type="String" Description="Genotype" julia> metainfotag(metainfo) "FORMAT" julia> metainfoval(metainfo) "<ID=GT,Number=1,Type=String,Description=\"Genotype\">" julia> keys(metainfo) 4-element Array{String,1}: "ID" "Number" "Type" "Description" julia> metainfo["ID"] "GT"
VCFRecord and BCFRecord objects support the following accessor functions (see the docstring of each accessor for the details):
| Accessor | Description |
|---|---|
chromosome |
chromosome name |
leftposition |
reference position |
identifier |
unique identifiers |
reference |
reference bases |
alternate |
alternate bases |
quality |
Phred-scaled quality score |
filter_ |
filter status |
information |
additional information |
infokeys |
keys of additional information |
format |
genotype format |
genotype |
genotype information |
julia> record = VCFRecord("20\t14370\trs6054257\tG\tA\t29\tPASS\tNS=3;DP=14;AF=0.5;DB;H2\tGT:GQ:DP:HQ\t0|0:48:1:51,51\t1|0:48:8:51,51") Bio.Var.VCFRecord: chromosome: 20 position: 14370 identifier: rs6054257 reference: G alternate: A quality: 29.0 filter: PASS information: NS=3 DP=14 AF=0.5 DB H2 format: GT GQ DP HQ genotype: [1] 0|0 48 1 51,51 [2] 1|0 48 8 51,51 julia> chromosome(record) Nullable{String}("20") julia> leftposition(record) Nullable{Int64}(14370) julia> identifier(record) 1-element Array{String,1}: "rs6054257" julia> reference(record) Nullable{String}("G") julia> alternate(record) 1-element Array{String,1}: "A" julia> quality(record) Nullable{Float64}(29.0) julia> filter_(record) 1-element Array{String,1}: "PASS" julia> information(record) 5-element Array{Pair{String,String},1}: "NS"=>"3" "DP"=>"14" "AF"=>"0.5" "DB"=>"" "H2"=>"" julia> information(record, "AF") "0.5" julia> format(record) 4-element Array{String,1}: "GT" "GQ" "DP" "HQ" julia> genotype(record) 2-element Array{Array{String,1},1}: String["0|0","48","1","51,51"] String["1|0","48","8","51,51"] julia> genotype(record, 1) 4-element Array{String,1}: "0|0" "48" "1" "51,51" julia> genotype(record, 1:2, "GT") 2-element Array{String,1}: "0|0" "1|0"
MASH Distances
MASH distances, based on MinHash sketches of genome sequences can provide rapid genome-scale sequence comparisons when sequence distance (not specific mutations) are all that's required.
A MinHash sketch is made by taking the s smallest hash values for kmers of length k for a given sequence. The genome distance for two genomes is then essentially the Jaccard index of the minhashes, with some additional modification to account for the size of the kmers used.
You can generate a MinHash sketch using the minhash() function in Bio.seq.
using Bio.Seq seq1 = dna"AAATAAGGCACAACTATGCAT" sketch1 = minhash(seq, 5, 10)
Then, if you have MinHash sketches with the same parameters for two sequences, you can determine the MASH distance between them.
seq2 = dna"AATTAACGCACGGACTGCGGTAAT" sketch2 = minhash(seq, 5, 10) using Bio.Var mashdistance(sketch1, sketch2)
For more information on what size kmers and what size sketches are appropriate for your use-case, see Odnov et. al. in Genome Biology.