Get started
Installation
You can install BioMarkovChains from the julia REPL. Press ] to enter pkg mode, and enter the following:
]add BioMarkovChainsIf you are interested in the cutting edge of the development, please check out the main branch to try new features before release.
Create a BioMarkovChain of DNA
using BioSequences, BioMarkovChains
seq = dna"CCTCCCGGACCCTGGGCTCGGGAC"
BioMarkovChain(seq)BioMarkovChain of DNA alphabet and order 1:
- Transition Probability Matrix -> Matrix{Float64}(4 × 4):
0.0 1.0 0.0 0.0
0.0 0.5 0.2 0.3
0.25 0.125 0.625 0.0
0.0 0.6667 0.3333 0.0
- Initial Probabilities -> Vector{Float64}(4 × 1):
0.087 0.4348 0.3478 0.1304Note that, sometimes the dinucleotides transition do not harbor important biological meaning, whereas trinucleotides or codons are, in fact, the building block of proteins. Therefore, sometimes the transition model we want to build is usually a second-order Markov chain, that represents the possible transitions of a trinucleotide.
A very nice nice property of the transition probability matrix is that the n-step transition probability matrix
BioMarkovChain(seq, 2)BioMarkovChain of DNA alphabet and order 2:
- Transition Probability Matrix -> Matrix{Float64}(4 × 4):
0.0 0.5 0.2 0.3
0.05 0.475 0.325 0.15
0.1562 0.3906 0.4156 0.0375
0.0833 0.375 0.3417 0.2
- Initial Probabilities -> Vector{Float64}(4 × 1):
0.087 0.4348 0.3478 0.1304